This repo contains the pytorch code for our paper “Diverse Database and Machine Learning Model to narrow the generalization gap in RNA structure prediction”
pip install efoldFrom a sequence:
efold AAACAUGAGGAUUACCCAUGU -o seq.txt
cat seq.txt
AAACAUGAGGAUUACCCAUGU
..(((((.((....)))))))or a fasta file:
efold --fasta example.fastaUsing different formats:
efold AAACAUGAGGAUUACCCAUGU -bp # base pairs
efold AAACAUGAGGAUUACCCAUGU -db # dotbracket (default)Output can be .json, .csv or .txt
efold AAACAUGAGGAUUACCCAUGU -o output.csvRun help:
efold -h>>> from efold import inference
>>> inference('AAACAUGAGGAUUACCCAUGU', fmt='dotbracket')
..(((((.((....)))))))Tested on a AMD EPYC 7272 12 core processor, with 32GB RAM and a RTX3090 GPU
efold/
api/ # for inference calls
core/ # backend
models/ # where we define eFold and other models
resources/
efold_weights.py # our best model weights
scripts/
efold_training.py # our training script
[...]
LICENSE
requirements.txt
pyproject.tomlA breakdown of the data we used is summarized here. All the data is stored on the HuggingFace.
You can download our datasets using rouskinHF:
pip install rouskinhfAnd in your code, write:
>>> import rouskinhf
>>> data = rouskinhf.get_dataset('ribo500-blast') # look at the dataset names on huggingfaceA training script is provided to train eFold from scratch.
A notebook is provided to run eFold inference on the four test sets, compute the F1 score and check the validity of the structures.
Plain text:
Albéric A. de Lajarte, Yves J. Martin des Taillades, Colin Kalicki, Federico Fuchs Wightman, Justin Aruda, Dragui Salazar, Matthew F. Allan, Casper L’Esperance-Kerckhoff, Alex Kashi, Fabrice Jossinet, Silvi Rouskin. “Diverse Database and Machine Learning Model to narrow the generalization gap in RNA structure prediction”. bioRxiv 2024.01.24.577093; doi: https://doi.org/10.1101/2024.01.24.577093. 2024
BibTex:
@article {Lajarte_Martin_2024,
title = {Diverse Database and Machine Learning Model to narrow the generalization gap in RNA structure prediction},
author = {Alb{\'e}ric A. de Lajarte and Yves J. Martin des Taillades and Colin Kalicki and Federico Fuchs Wightman and Justin Aruda and Dragui Salazar and Matthew F. Allan and Casper L{\textquoteright}Esperance-Kerckhoff and Alex Kashi and Fabrice Jossinet and Silvi Rouskin},
year = {2024},
doi = {10.1101/2024.01.24.577093},
URL = {https://www.biorxiv.org/content/early/2024/01/25/2024.01.24.577093},
journal = {bioRxiv}
}
